Cart 2 Product Products 234,90 € (empty)
-
1 x TPST1-tyro...121,50 € -
1 x PHF5A-PHD...113,40 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
Data sheet of BOC-Boc homolog (mouse) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BOC-Boc homolog (mouse) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034614 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BOC |
| Origin species: | Human |
| Product name: | BOC-Boc homolog (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC034614 |
| Gene id: | 91653 |
| Gene description: | Boc homolog (mouse) |
| Synonyms: | BOC cell adhesion associated, oncogene regulated; Boc homolog; CDON2; brother of CDO; brother of CDON; cell adhesion associated, oncogene regulated 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgcgtgggacgatgacggcgtggagaggaatgaggcctgaggtcacactggcttgcctcctcctagccacagcaggctgctttgctgacttgaacgaggtccctcaggtcaccgtccagcctgcgtccaccgtccagaagcccggaggcactgtgatcttgggctgcgtggtggaacctccaaggatgaatgtaacctggcgcctgaatggaaaggagctgaatggctcggatgatgctctgggtgtcctcatcacccacgggaccctcgtcatcactgcccttaacaaccacactgtgggacggtaccagtgtgtggcccggatgcctgcgggggctgtggccagcgtgccagccactgtgacactagccagtgagtctgctcctttgcctccctgccatggtgcggtccctcctcatctctcccaccctgaagcccccaccattcatgctgcctcttgttactcttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribonuclease T2 - protocadherin 20 - F-box protein 22 - ubiquitin-like 4A |