Cart 7 Product Products 807,04 € (empty)
-
1 x ZNF70-zinc...121,50 € -
1 x C14orf79-c...113,40 € -
1 x EGR3-early...121,50 € -
1 x RP11-265F1...121,50 € -
-
1 x TPD52-tumo...113,40 € -
No products
To be determined Shipping
807,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 807,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 807,04 €
Data sheet of CENPQ-centromere protein Q Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CENPQ-centromere protein Q Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016279 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CENPQ |
| Origin species: | Human |
| Product name: | CENPQ-centromere protein Q Gene |
| Size: | 2ug |
| Accessions: | BC016279 |
| Gene id: | 55166 |
| Gene description: | centromere protein Q |
| Synonyms: | C6orf139; CENP-Q; centromere protein Q |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagatttaactaatgtatcaagtctactgaatatggaaagggcacgagacaaagctaatgaagaaggtctggcattactacaggaagaaatagataaaatggtagagaccacagagttaatgactgggaatattcagagcctaaagaacaaaattcagattctggcaagtgaggtggaagaagaagaggagagagtaaaacagatgcatcaaataaatagtagtggagtactctctcttccggaactttctcagaaaactctcaaagcacccacacttcagaaagaaattttggcgctaattccaaaccagaatgctcttctaaaggacttggatattcttcataattcatcacagatgaagagcatgtcaaccttcattgaagaagcctataagaaactggatgcatcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteolipid protein 1 - synaptophysin-like 1 - bridging integrator 3 - IQ motif containing K |