HSPA4-heat shock 70kDa protein 4 Gene

View larger

HSPA4-heat shock 70kDa protein 4 Gene

Reference: PTXBC002526

Condition: New product

Print

Data sheet of HSPA4-heat shock 70kDa protein 4 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about HSPA4-heat shock 70kDa protein 4 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC002526
Product type:	DNA & cDNA
Ncbi symbol:	HSPA4
Origin species:	Human
Product name:	HSPA4-heat shock 70kDa protein 4 Gene
Size:	2ug
Accessions:	BC002526
Gene id:	3308
Gene description:	heat shock 70kDa protein 4
Synonyms:	APG-2; HEL-S-5a; HS24/P52; HSPH2; hsp70; hsp70RY; heat shock 70 kDa protein 4; epididymis secretory sperm binding protein Li 5a; heat shock 70-related protein APG-2; heat shock 70kD protein 4; heat shock 70kDa protein 4; heat shock protein, 110 kDa; hsp70 RY; heat shock protein family A (Hsp70) member 4
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgtcggtggtgggcatagacctgggcttccagagctgctacgtcgctgtggcccgcgccggcggcatcgagactatcgctaatgagtatagcgaccgctgcacgccggcttgcatttcttttggtcctaagaatcgttcaattggagcagcagctaaaagccaggtaatttctaatgcaaagaacacagtccaaggatttaaaagattccatggccgagcattctctgatccatttgtggaggcagaaaaatctaaccttgcatatgatattgtgcagttgcctacaggattaacaggtataaaggtgacatatatggaggaagagcagaatggaccagtggatggacaaggagacaacccaggcccccaggctgctgagcagggtacagacacagctgtgccttcggattcagacaagaagcttcctgaaatggacattgattga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- tumor protein D52-like 2 - cytochrome b5 reductase 2 - ring finger protein 113B - MAS-related GPR, member F

Reviews

Be the first to write your review !

Buy HSPA4-heat shock 70kDa protein 4 Gene now