TM6SF1-transmembrane 6 superfamily member 1 Gene View larger

TM6SF1-transmembrane 6 superfamily member 1 Gene

PTXBC032007

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TM6SF1-transmembrane 6 superfamily member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TM6SF1-transmembrane 6 superfamily member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032007
Product type: DNA & cDNA
Ncbi symbol: TM6SF1
Origin species: Human
Product name: TM6SF1-transmembrane 6 superfamily member 1 Gene
Size: 2ug
Accessions: BC032007
Gene id: 53346
Gene description: transmembrane 6 superfamily member 1
Synonyms: transmembrane 6 superfamily member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgcctctgcggccaccggggtcttcgtgctgtccctctcggccatcccggtcacctatgtcttcaaccacctggcggcccagcatgattcctggactattgtaggggttgctgccctcatcctgttcctggtagcactgctggctcgtgtcctcgtcaaaagaaaaccaccccgggacccactgttctatgtgtatgcagtttttggatttaccagcgtggtgaacctcatcataggactggagcaagatggaatcattgacgggttcatgacacactacttgagagagggtgaaccgtatctgaacaccgcatatgggcacatgatctgctactgggatggctctgctcattatctgatgtacctggtgatggtggcagccatagcatgggaatgctggcatatatgttctattctgttccttactttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CD300 molecule-like family member b
- solute carrier family 35, member B1
- secretory carrier membrane protein 3
- PML-RARA regulated adaptor molecule 1

Reviews

Buy TM6SF1-transmembrane 6 superfamily member 1 Gene now

Add to cart