Cart 1 Product Products 102,78 € (empty)
No products
To be determined Shipping
102,78 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 102,78 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 102,78 €
View larger 
TRAT1-T cell receptor associated transmembrane adaptor 1 Gene
PTXBC025713
New product
Data sheet of TRAT1-T cell receptor associated transmembrane adaptor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRAT1-T cell receptor associated transmembrane adaptor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025713 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRAT1 |
| Origin species: | Human |
| Product name: | TRAT1-T cell receptor associated transmembrane adaptor 1 Gene |
| Size: | 2ug |
| Accessions: | BC025713 |
| Gene id: | 50852 |
| Gene description: | T cell receptor associated transmembrane adaptor 1 |
| Synonyms: | HSPC062; TCRIM; pp29/30; T-cell receptor-associated transmembrane adapter 1; T cell receptor interacting molecule; T cell receptor associated transmembrane adaptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcaggaatctctgggtgcccctttttcctctggggacttctagcattgttgggcttggctttggttatatcactgatcttcaatatttcccactatgtggaaaagcaacgacaagataaaatgtacagctactccagtgaccacaccagggttgatgagtattatattgaagacacaccaatttatggtaacttagatgatatgatttcagaaccaatggatgaaaattgctatgaacaaatgaaagcccgaccagagaaatctgtaaataagatgcaggaagccaccccatctgcacaggcaaccaatgaaacacagatgtgctacgcctcacttgatcacagcgttaaggggaagcgtagaaagcccaggaaacagaatactcatttctcagacaaggatggagatgagcaactacatgcaatagatgccagcgtttctaagaccaccttagtagacagtttctccccagaaagccaggcagtagaggaaaacattcatgatgatcccatcagactgtttggattgatccgtgctaagagagaacctataaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ectonucleotide pyrophosphatase/phosphodiesterase 6 - ATG4 autophagy related 4 homolog C (S. cerevisiae) - adaptor-related protein complex 2, alpha 1 subunit - CKLF-like MARVEL transmembrane domain containing 8 |