Cart 20 Product Products 3 076,50 € (empty)
-
1 x C-Reactive...544,00 € -
1 x M6PR-manno...121,50 € -
-
1 x SPANXE-SPA...113,40 € -
1 x ARC-activi...121,50 € -
1 x SMCP-sperm...113,40 € -
-
1 x TM4SF18-tr...113,40 € -
1 x GC-group-s...121,50 € -
1 x NEU4-siali...121,50 € -
1 x TMEM31-tra...113,40 € -
1 x PLA2G2D-ph...113,40 € -
1 x C20orf177-...121,50 € -
1 x WDR53-WD...121,50 € -
1 x CCL22-chem...113,40 € -
1 x PRRG4-prol...113,40 € -
1 x MGC87631-s...113,40 € -
-
-
1 x POLB-polym...121,50 €
No products
To be determined Shipping
3 076,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 20 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 076,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 076,50 €
Data sheet of PTRH2-peptidyl-tRNA hydrolase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTRH2-peptidyl-tRNA hydrolase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006807 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTRH2 |
| Origin species: | Human |
| Product name: | PTRH2-peptidyl-tRNA hydrolase 2 Gene |
| Size: | 2ug |
| Accessions: | BC006807 |
| Gene id: | 51651 |
| Gene description: | peptidyl-tRNA hydrolase 2 |
| Synonyms: | BIT1; CFAP37; CGI-147; IMNEPD; PTH; PTH 2; PTH2; peptidyl-tRNA hydrolase 2, mitochondrial; bcl-2 inhibitor of transcription 1; cilia and flagella associated protein 37; peptidyl-tRNA hydrolase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccctccaaatccttggttatggaatatttggctcatcccagtacactcggcttggctgttggagttgcttgtggcatgtgcctgggctggagccttcgagtatgctttgggatgctccccaaaagcaagacgagcaagacacacacagatactgaaagtgaagcaagcatcttgggagacagcggggagtacaagatgattcttgtggttcgaaatgacttaaagatgggaaaagggaaagtggctgcccagtgctctcatgctgctgtttcagcctacaagcagattcaaagaagaaatcctgaaatgctcaaacaatgggaatactgtggccagcccaaggtggtggtcaaagctcctgatgaagaaaccctgattgcattattggcccatgcaaaaatgctgggactgactgtaagtttaattcaagatgctggacgtactcagattgcaccaggctctcaaactgtcctagggattgggccaggaccagcagacctaattgacaaagtcactggtcacctaaaactttactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cystatin F (leukocystatin) - MLF1 interacting protein - transmembrane protein 51 - histone cluster 2, H3a |