Cart 2 Product Products 234,90 € (empty)
-
1 x HCFC1R1-ho...113,40 € -
1 x DDX19B-DEA...121,50 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
View larger 
PHLDA2-pleckstrin homology-like domain, family A, member 2 Gene
PTXBC005034
New product
Data sheet of PHLDA2-pleckstrin homology-like domain, family A, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PHLDA2-pleckstrin homology-like domain, family A, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005034 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PHLDA2 |
| Origin species: | Human |
| Product name: | PHLDA2-pleckstrin homology-like domain, family A, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC005034 |
| Gene id: | 7262 |
| Gene description: | pleckstrin homology-like domain, family A, member 2 |
| Synonyms: | BRW1C; BWR1C; HLDA2; IPL; TSSC3; pleckstrin homology-like domain family A member 2; beckwith-Wiedemann syndrome chromosomal region 1 candidate gene C protein; imprinted in placenta and liver protein; p17-BWR1C; p17-Beckwith-Wiedemann region 1 C; p17-Beckwith-Wiedemann region 1C; tumor suppressing subchromosomal transferable fragment cDNA 3; tumor suppressing subtransferable candidate 3; tumor-suppressing subchromosomal transferable fragment candidate gene 3 protein; tumor-supressing STF cDNA 3; pleckstrin homology like domain family A member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaatcccccgacgaggtgctacgcgagggcgagttggagaagcgcagcgacagcctcttccagctatggaagaagaagcgcggggtgctcacctccgaccgcctgagcctgttccccgccagcccccgcgcgcgccccaaggagctgcgcttccactccatcctcaaggtggactgcgtggagcgcacgggcaagtacgtgtacttcaccatcgtcaccaccgaccacaaggagatcgacttccgctgcgcgggcgagagctgctggaacgcggccatcgcgctggcgctcatcgatttccagaaccgccgcgccctgcaggactttcgcagccgccaggaacgcaccgcacccgccgcacccgccgaggacgccgtggctgccgcggccgccgcaccctccgagccctcggagccctccaggccatccccgcagcccaaaccccgcacgccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - membrane-spanning 4-domains, subfamily A, member 15 - dynein, cytoplasmic 2, light intermediate chain 1 - low density lipoprotein receptor adaptor protein 1 - neural proliferation, differentiation and control, 1 |