Cart 9 Product Products 1 166,97 € (empty)
-
1 x SERPINA4-s...121,50 € -
-
1 x BRUNOL5-br...121,50 € -
1 x SERPINA10-...121,50 € -
1 x PMEPA1-pro...113,40 € -
1 x Phospho-HS...259,07 € -
-
-
1 x SERP1-stre...113,40 €
No products
To be determined Shipping
1 166,97 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 166,97 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 166,97 €
Data sheet of MRPL27-mitochondrial ribosomal protein L27 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL27-mitochondrial ribosomal protein L27 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001066 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL27 |
| Origin species: | Human |
| Product name: | MRPL27-mitochondrial ribosomal protein L27 Gene |
| Size: | 2ug |
| Accessions: | BC001066 |
| Gene id: | 51264 |
| Gene description: | mitochondrial ribosomal protein L27 |
| Synonyms: | L27mt; 39S ribosomal protein L27, mitochondrial; MRP-L27; mitochondrial ribosomal protein L27 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtcggtggtgttggcgctgaggacccggacagccgttacatccttgctaagccccactccggctacagctcttgctgtcagatacgcatccaagaagtcgggtggtagctccaaaaacctcggtggaaagtcatcaggcagacgccaaggcattaagaaaatggaaggtcactatgttcatgctgggaacatcattgcaacacagcgccatttccgctggcacccaggtgcccatgtgggtgttgggaagaataaatgtctgtatgccctggaagaggggatagtccgctacactaaggaggtctacgtgcctcatcccagaaacacggaggctgtggatctgatcaccaggctgcccaagggtgctgtgctctacaagacttttgtccacgtggttcctgccaagcctgagggcaccttcaaactggtagctatgctttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 3 open reading frame 22 - chromosome 3 open reading frame 52 - chromosome 3 open reading frame 18 - chromosome 9 open reading frame 46 |