Cart 3 Product Products 342,04 € (empty)
-
-
1 x IGF2-insul...113,40 € -
1 x HDGFRP3-he...113,40 €
No products
To be determined Shipping
342,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 342,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 342,04 €
View larger 
FABP5-fatty acid binding protein 5 (psoriasis-associated) Gene
PTXBC019385
New product
Data sheet of FABP5-fatty acid binding protein 5 (psoriasis-associated) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FABP5-fatty acid binding protein 5 (psoriasis-associated) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019385 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FABP5 |
| Origin species: | Human |
| Product name: | FABP5-fatty acid binding protein 5 (psoriasis-associated) Gene |
| Size: | 2ug |
| Accessions: | BC019385 |
| Gene id: | 2171 |
| Gene description: | fatty acid binding protein 5 (psoriasis-associated) |
| Synonyms: | E-FABP; EFABP; KFABP; PA-FABP; PAFABP; fatty acid-binding protein, epidermal; epidermal-type fatty acid-binding protein; fatty acid binding protein 5 (psoriasis-associated); psoriasis-associated fatty acid-binding protein homolog; fatty acid binding protein 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccacagttcagcagctggaaggaagatggcgcctggtggacagcaaaggctttgatgaatacatgaaggagctaggagtgggaatagctttgcgaaaaatgggcgcaatggccaagccagattgtatcatcacttgtgatggtaaaaacctcaccataaaaactgagagcactttgaaaacaacacagttttcttgtaccctgggagagaagtttgaagaaaccacagctgatggcagaaaaactcagactgtctgcaactttacagatggtgcattggttcagcatcaggagtgggatgggaaggaaagcacaataacaagaaaattgaaagatgggaaattagtggtggagtgtgtcatgaacaatgtcacctgtactcggatctatgaaaaagtagaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - uncoupling protein 2 (mitochondrial, proton carrier) - calcium channel, voltage-dependent, beta 1 subunit - ring finger and CHY zinc finger domain containing 1 - olfactory receptor, family 2, subfamily H, member 1 |