Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RABAC1-Rab acceptor 1 (prenylated) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RABAC1-Rab acceptor 1 (prenylated) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008950 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RABAC1 |
| Origin species: | Human |
| Product name: | RABAC1-Rab acceptor 1 (prenylated) Gene |
| Size: | 2ug |
| Accessions: | BC008950 |
| Gene id: | 10567 |
| Gene description: | Rab acceptor 1 (prenylated) |
| Synonyms: | PRAF1; YIP3; prenylated Rab acceptor protein 1; PRA1 domain family 1; PRA1 family protein 1; Rab acceptor 1 (prenylated); prenylated Rab acceptor 1; Rab acceptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagcgcagaaggaccagcagaaagatgccgaggcggaagggctgagcggcacgaccctgctgccgaagctgattccctccggtgcaggccgggagtggctggagcggcgccgcgcgaccatccggccctggagcaccttcgtggaccagcagcgcttctcacggccccgcaacctgggagagctgtgccagcgcctcgtacgcaacgtggagtactaccagagcaactatgtgttcgtgttcctgggcctcatcctgtactgtgtggtgacgtcccctatgttgctggtggctctggctgtctttttcggcgcctgttacattctctatctgcgcaccttggagtccaagcttgtgctctttggccgagaggtgagcccagcgcatcagtatgctctggctggaggcatctccttccccttcttctggctggctggtgcgggctcggccgtcttctgggtgctgggagccaccctggtggtcatcggctcccacgctgccttccaccagattgaggctgtggacggggaggagctgcagatggaacccgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - receptor accessory protein 4 - receptor accessory protein 2 - polycomb group ring finger 3 - N-methylpurine-DNA glycosylase |