Cart 1 Product Products 113,40 € (empty)
-
1 x JOSD1-Jose...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of CA6-carbonic anhydrase VI Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CA6-carbonic anhydrase VI Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034350 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CA6 |
| Origin species: | Human |
| Product name: | CA6-carbonic anhydrase VI Gene |
| Size: | 2ug |
| Accessions: | BC034350 |
| Gene id: | 765 |
| Gene description: | carbonic anhydrase VI |
| Synonyms: | CA-VI; GUSTIN; carbonic anhydrase 6; carbonate dehydratase VI; carbonic anhydrase VI nirs variant 2; salivary carbonic anhydrase; secreted carbonic anhydrase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagggccctggtgcttctgctgtccctgttcctgctgggtggccaggcccagcatgtgtctgactggacctactcagaaggggcactggacgaagcgcactggccacagcactaccccgcctgtgggggccagagacagtcgcctatcaacctacagaggacgaaggtgcggtacaacccctccttgaaggggctcaatatgacaggctatgagacccaggcaggggagttccccatggtcaacaatggccacacagattggcaggcggaactcttcctcccctccttgtcctctccttgtggagaaggggcgaagcacaaaggccaaaggcagtggctttgttcaccctccctggacagctggtgggaagcaatcattgatggaggatctctatgggcaacgcttgctgagtgcgggcttcgtgctgagggcccagaagagggaaggcatatggaagagaagagcccagcttcccaaggggcttgcagcggctcccgcctcccaatttccagaggaccctgtaccttcttcctttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - AHNAK nucleoprotein - WD repeat domain 85 - WD repeat domain 32 - carbonyl reductase 1 |