Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MYL6-myosin, light chain 6, alkali, smooth muscle and non-muscle Gene
PTXBC006781
New product
Data sheet of MYL6-myosin, light chain 6, alkali, smooth muscle and non-muscle Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MYL6-myosin, light chain 6, alkali, smooth muscle and non-muscle Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006781 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MYL6 |
| Origin species: | Human |
| Product name: | MYL6-myosin, light chain 6, alkali, smooth muscle and non-muscle Gene |
| Size: | 2ug |
| Accessions: | BC006781 |
| Gene id: | 4637 |
| Gene description: | myosin, light chain 6, alkali, smooth muscle and non-muscle |
| Synonyms: | ESMLC; LC17; LC17-GI; LC17-NM; LC17A; LC17B; MLC-3; MLC1SM; MLC3NM; MLC3SM; myosin light polypeptide 6; 17 kDa myosin light chain; myosin light chain A3; myosin light chain alkali 3; myosin, light chain 6, alkali, smooth muscle and non-muscle; myosin, light polypeptide 6, alkali, smooth muscle and non-muscle; myosin light chain 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgtgacttcaccgaagaccagaccgcagagttcaaggaggccttccagctgtttgaccgaacaggtgatggcaagatcctgtacagccagtgtggggatgtgatgagggccctgggccagaaccctaccaacgccgaggtgctcaaggtcctggggaaccccaagagtgatgagatgaatgtgaaggtgctggactttgagcactttttgcccatgctgcagacagtggccaagaacaaggaccagggcacctatgaggattatgtcgaaggacttcgggtgtttgacaaggaaggaaatggcaccgtcatgggtgctgaaatccggcatgttcttgtcacactgggtgagaagatgacagaggaagaagtagagatgctggtggcagggcatgaggacagcaatggttgtatcaactatgaagagctcgtccgcatggtgctgaatggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - roundabout, axon guidance receptor, homolog 3 (Drosophila) - IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) - IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) - proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 |