Cart 1 Product Products 113,40 € (empty)
-
1 x JOSD1-Jose...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of RPL27-ribosomal protein L27 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPL27-ribosomal protein L27 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021886 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPL27 |
| Origin species: | Human |
| Product name: | RPL27-ribosomal protein L27 Gene |
| Size: | 2ug |
| Accessions: | BC021886 |
| Gene id: | 6155 |
| Gene description: | ribosomal protein L27 |
| Synonyms: | L27; 60S ribosomal protein L27; ribosomal protein L27 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcaaaacaaagcatctaaaaccgcagtttctggaagaaccacttgtcctggctggacgctactccggacgcaaagctgtcatcgtgaagaacattgatgatggcacctcagatcgcccctacagccatgctctggtggctggaattgaccgctacccccgcaaagtgacagctgccatgggcaagaagaagatcgccaagagatcaaagataaaatcttttgtgaaagtgtataactacaatcacctaatgcccacaaggtactctgtggatatccccttggacaaaactgtcgtcaataaggatgtcttcagagatcctgctcttaaacgcaaggcccgacgggaggccaaggtcaagtttgaagagagatacaagacaggcaagaacaagtggttcttccagaaactgcggttttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carbonic anhydrase VIII - ribosomal protein L32 - ribosomal protein S14 - WBP2 N-terminal like |