Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DEFA3-defensin, alpha 3, neutrophil-specific Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DEFA3-defensin, alpha 3, neutrophil-specific Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027917 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DEFA3 |
| Origin species: | Human |
| Product name: | DEFA3-defensin, alpha 3, neutrophil-specific Gene |
| Size: | 2ug |
| Accessions: | BC027917 |
| Gene id: | 1668 |
| Gene description: | defensin, alpha 3, neutrophil-specific |
| Synonyms: | DEF3; HNP-3; HNP3; HP-3; HP3; neutrophil defensin 3; defensin 3, neutrophil-specific; defensin, alpha 3, neutrophil-specific; neutrophil peptide 3; defensin alpha 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggaccctcgccatccttgctgccattctcctggtggccctgcaggcccaggctgagccactccaggcaagagctgatgaggttgctgcagccccggagcagattgcagcggacatcccagaagtggttgtttcccttgcatgggacgaaagcttggctccaaagcatccaggctcaaggaaaaacatggactgctattgcagaataccagcgtgcattgcaggagaacgtcgctatggaacctgcatctaccagggaagactctgggcattctgctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 14 open reading frame 65 - chromosome 6 open reading frame 134 - chromosome 17 open reading frame 62 - chromosome 11 open reading frame 74 |