> >>MRPL51-mitochondrial ribosomal protein L51 Gene
MRPL51-mitochondrial ribosomal protein L51 Gene View larger

MRPL51-mitochondrial ribosomal protein L51 Gene

PTXBC000191

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of MRPL51-mitochondrial ribosomal protein L51 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL51-mitochondrial ribosomal protein L51 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000191
Product type: DNA & cDNA
Ncbi symbol: MRPL51
Origin species: Human
Product name: MRPL51-mitochondrial ribosomal protein L51 Gene
Size: 2ug
Accessions: BC000191
Gene id: 51258
Gene description: mitochondrial ribosomal protein L51
Synonyms: CDA09; HSPC241; MRP64; bMRP64; 39S ribosomal protein L51, mitochondrial; L51mt; MRP-L51; bMRP-64; mitochondrial ribosomal protein 64; mitochondrial ribosomal protein bMRP64; mitochondrial ribosomal protein L51
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagggaacctcttatccggggcaggtaggcgcctgtgggactgggtgcctctggcgtgcagaagcttctctcttggtgtgcctagattgatcggtataaggctcactctcccgccccccaaagtggttgatcgttggaacgagaaaagggccatgttcggagtgtatgacaacatcgggatcctgggaaactttgaaaagcaccccaaagaactgatcagggggcccatatggcttcgaggttggaaagggaatgaattgcaacgttgtatccgaaagaggaaaatggttggaagtagaatgttcgctgatgacctgcacaaccttaataaacgcatccgctatctctacaaacactttaaccgacatgggaagtttcgatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 4 open reading frame 36
- chromosome 7 open reading frame 34
- interferon, alpha-inducible protein 6
- lymphocyte antigen 6 complex, locus H

Reviews

Buy MRPL51-mitochondrial ribosomal protein L51 Gene now

Add to cart