LOH3CR2A-loss of heterozygosity, 3, chromosomal region 2, gene A Gene

View larger

LOH3CR2A-loss of heterozygosity, 3, chromosomal region 2, gene A Gene

Reference: PTXBC016278

Condition: New product

Print

Data sheet of LOH3CR2A-loss of heterozygosity, 3, chromosomal region 2, gene A Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about LOH3CR2A-loss of heterozygosity, 3, chromosomal region 2, gene A Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC016278
Product type:	DNA & cDNA
Ncbi symbol:	LOH3CR2A
Origin species:	Human
Product name:	LOH3CR2A-loss of heterozygosity, 3, chromosomal region 2, gene A Gene
Size:	2ug
Accessions:	BC016278
Gene id:	29931
Gene description:	loss of heterozygosity, 3, chromosomal region 2, gene A
Synonyms:	LOH3CR2A; ERR-10; ERR10; NAG-7; NCRNA00312; long intergenic non-protein coding RNA 312
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggcccatcattctttaaacacattttacatctggcacaataacgtgctacatacccatcttgtatttttcctgccccatcttttaaatcagccattctcaaggggttccttcttaatctggctgttgttgtgttggaactcctggtaccatcttagaaccttaaggagacaagcgaaccaagccaataagctttccatgatgctgcttagagttaaacagagcccaggtactaagttatgtcatggagacagtgaactaacctctggactgcttgctacatga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- myosin, light chain 6, alkali, smooth muscle and non-muscle - roundabout, axon guidance receptor, homolog 3 (Drosophila) - IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) - IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)

Reviews

Be the first to write your review !

Buy LOH3CR2A-loss of heterozygosity, 3, chromosomal region 2, gene A Gene now