HIST2H2AA4-histone cluster 2, H2aa4 Gene View larger

HIST2H2AA4-histone cluster 2, H2aa4 Gene

PTXBC001629

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST2H2AA4-histone cluster 2, H2aa4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIST2H2AA4-histone cluster 2, H2aa4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001629
Product type: DNA & cDNA
Ncbi symbol: HIST2H2AA4
Origin species: Human
Product name: HIST2H2AA4-histone cluster 2, H2aa4 Gene
Size: 2ug
Accessions: BC001629
Gene id: 723790
Gene description: histone cluster 2, H2aa4
Synonyms: H2A/R; histone H2A type 2-A; histone 2, H2aa4; histone H2A/r; histone cluster 2, H2aa4; histone cluster 2 H2A family member a4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggtcgtggcaagcaaggaggcaaggcccgcgccaaggccaagtcgcgctcgtcccgcgctggccttcagttcccggtagggcgagtgcatcgcttgctgcgcaaaggcaactacgcggagcgagtgggggccggcgcgcccgtctacatggctgcggtcctcgagtatctgaccgccgagatcctggagctggcgggcaacgcggctcgggacaacaagaagacgcgcatcatccctcgtcacctccagctggccatccgcaacgacgaggaactgaacaagctgctgggcaaagtcaccatcgcccagggcggcgtcttgcctaacatccaggccgtactgctccctaagaagacggagagtcaccacaaggcaaagggcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 5', 3'-nucleotidase, cytosolic
- rhomboid domain containing 2
- corticotropin releasing hormone
- endothelin converting enzyme 2

Reviews

Buy HIST2H2AA4-histone cluster 2, H2aa4 Gene now

Add to cart