> >>FABP6-fatty acid binding protein 6, ileal Gene
FABP6-fatty acid binding protein 6, ileal Gene View larger

FABP6-fatty acid binding protein 6, ileal Gene

PTXBC022489

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of FABP6-fatty acid binding protein 6, ileal Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FABP6-fatty acid binding protein 6, ileal Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022489
Product type: DNA & cDNA
Ncbi symbol: FABP6
Origin species: Human
Product name: FABP6-fatty acid binding protein 6, ileal Gene
Size: 2ug
Accessions: BC022489
Gene id: 2172
Gene description: fatty acid binding protein 6, ileal
Synonyms: I-15P; I-BABP; I-BALB; I-BAP; ILBP; ILBP3; ILLBP; gastrotropin; fatty acid binding protein 6, ileal; ileal bile acid binding protein; ileal lipid-binding protein; illeal lipid-binding protein; intestinal 15 kDa protein; fatty acid binding protein 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctttcaccggcaagttcgagatggagagtgagaagaattatgatgagttcatgaagctccttgggatctccagcgatgtaatcgaaaaggcccacaacttcaagatcgtcacggaggtgcagcaggatgggcaggacttcacttggtcccagcactactacgggggccacaccatgaccaacaagttcactgttggcaaggaaagcaacatacagacaatggggggcaagacgttcaaggccactgtgcagatggagggcgggaagctggtggtgaatttccccaactatcaccagacctcagagatcgtgggtgacaagctggtggaggtctccaccatcggaggcgtgacctatgagcgcgtgagcaagagactggcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - endothelial cell-specific molecule 1
- gap junction protein, alpha 4, 37kDa
- Fas apoptotic inhibitory molecule 2
- coiled-coil domain containing 106

Reviews

Buy FABP6-fatty acid binding protein 6, ileal Gene now

Add to cart