Cart 2 Product Products 205,56 € (empty)
No products
To be determined Shipping
205,56 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 205,56 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 205,56 €
Data sheet of ZNF585A-zinc finger protein 585A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNF585A-zinc finger protein 585A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026081 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNF585A |
| Origin species: | Human |
| Product name: | ZNF585A-zinc finger protein 585A Gene |
| Size: | 2ug |
| Accessions: | BC026081 |
| Gene id: | 199704 |
| Gene description: | zinc finger protein 585A |
| Synonyms: | zinc finger protein 585A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccagctaattggacctcacctcagaaatcctcagccctggctccagaggatcatggcagctcctatgagggatcagtgtccttcagggatgtggctatcgatttcagcagagaggaatggcggcacctggacccttctcagagaaacctgtaccgggatgtgatgctggagacctacagccacctgctctcaataggatatcaagttcctgaagcagaggtggtcatgttggagcaaggaaaggaaccatgggcactgcagggtgagaggccacgtcagagctgcccagcaccgtgtcttgtgaactcccatcaccttcaagaaagcttccgagggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor protein D52-like 3 - heat shock 70kDa protein 4 - tumor protein D52-like 2 - cytochrome b5 reductase 2 |