Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMD14-proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Gene
PTXBC009524
New product
Data sheet of PSMD14-proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMD14-proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009524 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMD14 |
| Origin species: | Human |
| Product name: | PSMD14-proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Gene |
| Size: | 2ug |
| Accessions: | BC009524 |
| Gene id: | 10213 |
| Gene description: | proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 |
| Synonyms: | PAD1; POH1; RPN11; 26S proteasome non-ATPase regulatory subunit 14; 26S proteasome regulatory subunit rpn11; 26S proteasome-associated PAD1 homolog 1; proteasome (prosome, macropain) 26S subunit, non-ATPase, 14; testis tissue sperm-binding protein Li 69n; proteasome 26S subunit, non-ATPase 14 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgctaaatttgcataagaagagttggatggaaggtttgacacttcaggactacagtgaacattgtaaacacaatgaatcagtggtaaaagagatgttggaattagccaagaattacaataaggctgtagaagaagaagataagatgacacctgaacagctggcaataaagaatgttggcaagcaggaccccaaacgtcatttggaggaacatgtggatgtacttatgacctcaaatattgtccagtgtttagcagctatgttggatactgtcgtatttaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa - LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) - myosin, light chain 6B, alkali, smooth muscle and non-muscle - proline-serine-threonine phosphatase interacting protein 2 |