Cart 12 Product Products 1 409,40 € (empty)
-
1 x TXNDC11-th...121,50 € -
1 x KCTD18-pot...121,50 € -
1 x LIMD2-LIM...113,40 € -
1 x RBM11-RNA...121,50 € -
1 x PSMA2-prot...113,40 € -
1 x CCDC21-coi...113,40 € -
1 x C11orf57-c...113,40 € -
1 x C19orf50-c...113,40 € -
1 x GABPB1-GA...121,50 € -
1 x PRPS2-phos...121,50 € -
1 x NUP37-nucl...121,50 € -
1 x C1orf128-c...113,40 €
No products
To be determined Shipping
1 409,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 409,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 409,40 €
View larger 
SLC30A5-solute carrier family 30 (zinc transporter), member 5 Gene
PTXBC000808
New product
Data sheet of SLC30A5-solute carrier family 30 (zinc transporter), member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC30A5-solute carrier family 30 (zinc transporter), member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000808 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC30A5 |
| Origin species: | Human |
| Product name: | SLC30A5-solute carrier family 30 (zinc transporter), member 5 Gene |
| Size: | 2ug |
| Accessions: | BC000808 |
| Gene id: | 64924 |
| Gene description: | solute carrier family 30 (zinc transporter), member 5 |
| Synonyms: | ZNT5; ZNTL1; ZTL1; ZnT-5; zinc transporter 5; solute carrier family 30 (zinc transporter), member 5; zinc transporter ZTL1; znT-like transporter 1; solute carrier family 30 member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagaaatacggcggggacgtgctggccggccccggcggcggcggcggccttgggccggtggacgtacccagcgctcgattaacaaaatatattgtgttactatgtttcactaaatttttgaaggctgtgggacttttcgaatcatatgatctcctaaaagctgttcacattgttcagttcatttttatattaaaacttgggactgcattttttatggttttgtttcaaaagccattttcttctgggaaaactattaccaaacaccagataattggatcactaaaaattcctggtagaaaagaatttaaagacaaaaagttaaatgatcctaggaaactagtgggaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor necrosis factor (ligand) superfamily, member 12 - G-protein signaling modulator 3 (AGS3-like, C. elegans) - tumor necrosis factor (ligand) superfamily, member 10 - eukaryotic translation initiation factor 4A, isoform 2 |