Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FABP7-fatty acid binding protein 7, brain Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FABP7-fatty acid binding protein 7, brain Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012299 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FABP7 |
| Origin species: | Human |
| Product name: | FABP7-fatty acid binding protein 7, brain Gene |
| Size: | 2ug |
| Accessions: | BC012299 |
| Gene id: | 2173 |
| Gene description: | fatty acid binding protein 7, brain |
| Synonyms: | B-FABP; BLBP; FABPB; MRG; fatty acid-binding protein, brain; brain lipid-binding protein; brain-type fatty acid-binding protein; mammary-derived growth inhibitor-related; fatty acid binding protein 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggaggctttctgtgctacctggaagctgaccaacagtcagaactttgatgagtacatgaaggctctaggcgtgggctttgccactaggcaggtgggaaatgtgaccaaaccaacggtaattatcagtcaagaaggagacaaagtggtcatcaggactctcagcacattcaagaacacggagattagtttccagctgggagaagagtttgatgaaaccactgcagatgatagaaactgtaagtctgttgttagcctggatggagacaaacttgttcacatacagaaatgggatggcaaagaaacaaattttgtaagagaaattaaggatggcaaaatggttatgacccttacttttggtgatgtggttgctgttcgccactatgagaaggcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fatty acid binding protein 6, ileal - endothelial cell-specific molecule 1 - gap junction protein, alpha 4, 37kDa - Fas apoptotic inhibitory molecule 2 |