PRR15-proline rich 15 Gene

View larger

PRR15-proline rich 15 Gene

Reference: PTXBC029131

Condition: New product

Print

Data sheet of PRR15-proline rich 15 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about PRR15-proline rich 15 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC029131
Product type:	DNA & cDNA
Ncbi symbol:	PRR15
Origin species:	Human
Product name:	PRR15-proline rich 15 Gene
Size:	2ug
Accessions:	BC029131
Gene id:	222171
Gene description:	proline rich 15
Synonyms:	proline-rich protein 15; proline rich 15
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggccgacagcggcgatgctggcagctccggcccctggtggaaatcgctcaccaacagcagaaagaaaagcaaggaagccgcagtgggggtgccgcctcccgcccagcccgctcccggggagcccacgccacctgcgccgcccagcccggactggaccagcagctcccgggagaaccagcaccccaatctcctcgggggcgccggcgagccccccaaaccagacaagttatacggggacaaatccggcagcagccgccgcaatttgaagatctcgcgctccggccgctttaaggagaagaggaaagtgcgcgccacgctgctcccggaggcgggcaggtccccggaggaggcaggctttcctggtgacccccacgaggacaagcagtag
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- trefoil factor 2 - prepronociceptin - cytokine-like 1 - tubulin, beta 6

Reviews

Be the first to write your review !

Buy PRR15-proline rich 15 Gene now