> >>MGC4294-hypothetical protein MGC4294 Gene
MGC4294-hypothetical protein MGC4294 Gene View larger

MGC4294-hypothetical protein MGC4294 Gene

PTXBC002831

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of MGC4294-hypothetical protein MGC4294 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC4294-hypothetical protein MGC4294 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002831
Product type: DNA & cDNA
Ncbi symbol: MGC4294
Origin species: Human
Product name: MGC4294-hypothetical protein MGC4294 Gene
Size: 2ug
Accessions: BC002831
Gene id: 79160
Gene description: hypothetical protein MGC4294
Synonyms: uncharacterized MGC4294
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgctcctggcccaggagtggggggctgcctcacacctgctgctgtggggcagagtctctcctgggtcggggcctcgctggcggatctgctccatgtcgtgtgatgtgctgcagccccgcgtcaccgagagcctcttatgggccaccaagtccacacagccactggccatggggcaccctgcagggcctctggacacggagacctgtggttctcagccagtggtgattttgtgtccagggaacacctggccaagtctgggttcaattttgtttgtcacagtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fracture callus 1 homolog (rat)
- natriuretic peptide precursor B
- FK506 binding protein 3, 25kDa
- sorting nexin family member 21

Reviews

Buy MGC4294-hypothetical protein MGC4294 Gene now

Add to cart