Cart 12 Product Products 1 385,10 € (empty)
-
1 x VENTX-VENT...113,40 € -
1 x SSX1-synov...113,40 € -
1 x PSME1-prot...113,40 € -
1 x RP11-191L9...113,40 € -
1 x C18orf21-c...113,40 € -
1 x LSMD1-LSM...113,40 € -
1 x C3orf49-ch...121,50 € -
1 x STK3-serin...121,50 € -
1 x FAM96B-fam...113,40 € -
1 x RAP2C-RAP2...113,40 € -
1 x RNF26-ring...121,50 € -
1 x SPANXN4-SP...113,40 €
No products
To be determined Shipping
1 385,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 385,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 385,10 €
Data sheet of PFN4-profilin family, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PFN4-profilin family, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029523 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PFN4 |
| Origin species: | Human |
| Product name: | PFN4-profilin family, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC029523 |
| Gene id: | 375189 |
| Gene description: | profilin family, member 4 |
| Synonyms: | profilin-4; profilin IV; profilin family member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccatttgcagagcttattgttagacaccctcttgggaaccaagcatgtggacagtgcagccctcatcaaaatccaggagcggagcttgtgtgtagcatcaccaggtttcaatgtaacgcccagtgatgtccgaacactggtgaatggatttgccaagaaccctttgcaagcccgaagagaaggactgtatttcaagggaaaagattacagatgtgtccgggcagatgaatattctctttatgccaaaaatgagaacactggtgtggttgtcgtgaagacccatctgtatcttctggtagcaacttacactgagggcatgtatcctagcatctgtgtggaagccacagagagcctgggagactacctaagaaaaaaaggaagttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - numb homolog (Drosophila) - glycoprotein IX (platelet) - 6-phosphogluconolactonase - CUE domain containing 2 |