RPL35-ribosomal protein L35 Gene View larger

RPL35-ribosomal protein L35 Gene

PTXBC000348

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL35-ribosomal protein L35 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL35-ribosomal protein L35 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000348
Product type: DNA & cDNA
Ncbi symbol: RPL35
Origin species: Human
Product name: RPL35-ribosomal protein L35 Gene
Size: 2ug
Accessions: BC000348
Gene id: 11224
Gene description: ribosomal protein L35
Synonyms: L35; 60S ribosomal protein L35; ribosomal protein L35
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaagatcaaggctcgagatcttcgcgggaagaagaaggaggagctgctgaaacagctggacgacctgaaggtggagctgtcccagctgcgcgtcgccaaagtgacaggcggtgcggcctccaagctctctaagatccgagtcgtccggaaatccattgcccgtgttctcacagttattaaccagactcagaaagaaaacctcaggaaattctacaagggcaagaagtacaagcccctggacctgcggcctaagaagacacgtgccatgcgccgccggctcaacaagcacgaggagaacctgaagaccaagaagcagcagcggaaggagcggctgtacccgctgcggaagtacgcggtcaaggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - c-myc binding protein
- ribosomal protein L27
- carbonic anhydrase VIII
- ribosomal protein L32

Reviews

Buy RPL35-ribosomal protein L35 Gene now

Add to cart