Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ARHGAP17-Rho GTPase activating protein 17 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARHGAP17-Rho GTPase activating protein 17 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001241 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARHGAP17 |
| Origin species: | Human |
| Product name: | ARHGAP17-Rho GTPase activating protein 17 Gene |
| Size: | 2ug |
| Accessions: | BC001241 |
| Gene id: | 55114 |
| Gene description: | Rho GTPase activating protein 17 |
| Synonyms: | MST066; MST110; MSTP038; MSTP066; MSTP110; NADRIN; PP367; PP4534; RICH-1; RICH1; WBP15; rho GTPase-activating protein 17; RhoGAP interacting with CIP4 homologs 1; neuron-associated developmentally regulated protein; rho-type GTPase-activating protein 17; Rho GTPase activating protein 17 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcacaccaaacccaatagccagggccctcccaaccccatggcattgcccagtgagcatggacttgagcagccatctcacacccctccccagactccaacgccccccagtactccgcccctaggaaaacagaaccccagtctgccagctcctcagaccctggcagggggtaaccctgaaactgcacagccacatgctggaaccttaccgagaccgagaccagtaccaaagccaaggaaccggcccagcgtgcccccacccccccaacctcctggtgtccactcagctggggacagcagcctcaccaacacagcaccaacagcttccaagatagtaacagatgtatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fatty acid binding protein 7, brain - fatty acid binding protein 6, ileal - endothelial cell-specific molecule 1 - gap junction protein, alpha 4, 37kDa |