PTXBC034248
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC034248 |
Product type: | DNA & cDNA |
Ncbi symbol: | NBR2 |
Origin species: | Human |
Product name: | NBR2-neighbor of BRCA1 gene 2 Gene |
Size: | 2ug |
Accessions: | BC034248 |
Gene id: | 10230 |
Gene description: | neighbor of BRCA1 gene 2 |
Synonyms: | NCRNA00192; neighbor of BRCA1 gene 2 (non-protein coding) |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atgtggaaaggaggtagaagtcatcctttcctcccctgtagcagcaggcgtgcaggctctggtggtcagctggactccatactcccccaccagtcaccagcctggggaccgtggggctgcaaggacctcagcagcggtgtcccaagtttcctgacttcttccatcctctggaaatcagctgtggtaaagtag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - ribosomal protein S15a - ribosomal protein L37a - acyl-CoA thioesterase 4 - AKT interacting protein |