> >>TSLP-thymic stromal lymphopoietin Gene
TSLP-thymic stromal lymphopoietin Gene View larger

TSLP-thymic stromal lymphopoietin Gene

PTXBC016720

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of TSLP-thymic stromal lymphopoietin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TSLP-thymic stromal lymphopoietin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016720
Product type: DNA & cDNA
Ncbi symbol: TSLP
Origin species: Human
Product name: TSLP-thymic stromal lymphopoietin Gene
Size: 2ug
Accessions: BC016720
Gene id: 85480
Gene description: thymic stromal lymphopoietin
Synonyms: thymic stromal lymphopoietin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaaactaaggctgccttagctatctggtgcccaggctattcggaaactcagataaatgctactcaggcaatgaagaagaggagaaaaaggaaagtcacaaccaataaatgtctggaacaagtgtcacaattacaaggattgtggcgtcgcttcaatcgacctttactgaaacaacagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nescient helix loop helix 1
- transmembrane protein 148
- transmembrane protein 14B
- histone cluster 1, H2ac

Reviews

Buy TSLP-thymic stromal lymphopoietin Gene now

Add to cart