Cart 60 Product Products 7 455,90 € (empty)
-
1 x ERMP1-endo...121,50 € -
1 x SLC38A5-so...121,50 € -
1 x THTPA-thia...113,40 € -
1 x CENPQ-cent...113,40 € -
1 x SFRS16-spl...113,40 € -
1 x C1orf52-ch...113,40 € -
1 x TNF-tumor...113,40 € -
1 x SDHALP2-su...113,40 € -
1 x TK1-thymid...113,40 € -
1 x PRSS22-pro...121,50 € -
1 x AGA-aspart...121,50 € -
1 x NKAPL-NFKB...121,50 € -
1 x STX17-synt...113,40 € -
-
1 x CMPK1-cyti...113,40 € -
1 x REEP5-rece...113,40 € -
1 x NCOA5-nucl...121,50 € -
1 x LPAR3-lyso...121,50 € -
-
-
1 x C15orf15-c...113,40 € -
1 x KDELR2-KDE...113,40 € -
1 x TNFRSF1B-t...121,50 € -
-
1 x C13orf16-c...113,40 € -
1 x SH2D4A-SH2...121,50 € -
1 x FAM108C1-f...121,50 € -
1 x C16orf14-c...113,40 € -
1 x GOLGA7-gol...113,40 € -
1 x HNRNPA1-he...121,50 € -
1 x FBXO32-F-b...113,40 € -
1 x HSF5-heat...121,50 € -
-
1 x HVCN1-hydr...121,50 € -
1 x FOXN2-fork...121,50 € -
1 x LRMP-lymph...121,50 € -
1 x RPS26-ribo...113,40 € -
1 x RPL39L-rib...113,40 € -
1 x C18orf10-c...113,40 € -
1 x C1orf21-ch...113,40 € -
1 x Phospho-Mc...259,07 € -
1 x FKBP1A-FK5...113,40 € -
1 x RFPL4B-ret...113,40 € -
1 x ASTL-astac...121,50 € -
1 x STX8-synta...113,40 € -
1 x MAGED4B-me...121,50 € -
1 x HP1BP3-het...113,40 € -
1 x SLC35F1-so...121,50 € -
-
1 x HNRNPK-het...121,50 € -
1 x TXNDC5-thi...121,50 € -
1 x COG8-compo...113,40 € -
1 x MAGEF1-mel...121,50 € -
1 x GPR109A-G...121,50 € -
1 x Rho H...259,07 € -
1 x FPR1-formy...121,50 € -
1 x RNF113B-ri...121,50 € -
-
1 x DIO1-deiod...113,40 € -
No products
To be determined Shipping
7 455,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 60 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 455,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 455,90 €
Data sheet of KIAA1147-KIAA1147 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIAA1147-KIAA1147 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012493 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIAA1147 |
| Origin species: | Human |
| Product name: | KIAA1147-KIAA1147 Gene |
| Size: | 2ug |
| Accessions: | BC012493 |
| Gene id: | 57189 |
| Gene description: | KIAA1147 |
| Synonyms: | LCHN; PRO2561; protein LCHN |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttcttgaattgattttgttctgtggtacaaataacatctatgaatatcatatctgtatatatctgaaccaagttgtgtgcagagaggttgatataactatatttacagaaaatgatttttacaattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - parathymosin - casein kappa - G antigen 1 - calbindin 2 |