DSCR8-Down syndrome critical region gene 8 Gene

View larger

DSCR8-Down syndrome critical region gene 8 Gene

Reference: PTXBC015981

Condition: New product

Print

Data sheet of DSCR8-Down syndrome critical region gene 8 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about DSCR8-Down syndrome critical region gene 8 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC015981
Product type:	DNA & cDNA
Ncbi symbol:	DSCR8
Origin species:	Human
Product name:	DSCR8-Down syndrome critical region gene 8 Gene
Size:	2ug
Accessions:	BC015981
Gene id:	84677
Gene description:	Down syndrome critical region gene 8
Synonyms:	C21orf65; CT25.1a; CT25.1b; MMA-1; MMA-1a; MMA-1b; MMA1; MTAG2; Down syndrome critical region gene 8
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgaaggagcctggacccaactttgttactgtgagaaagggtcttcattcattcaagatggcatttgttaagcacctactacaaaccttggaaatcaagaaagttctggaatga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- chromosome 8 open reading frame 59 - mitochondrial ribosomal protein L34 - chromosome 9 open reading frame 97 - chromosome 2 open reading frame 52

Reviews

Be the first to write your review !

Buy DSCR8-Down syndrome critical region gene 8 Gene now