Cart 7 Product Products 807,04 € (empty)
-
1 x ZNF70-zinc...121,50 € -
1 x C14orf79-c...113,40 € -
1 x EGR3-early...121,50 € -
1 x RP11-265F1...121,50 € -
-
1 x TPD52-tumo...113,40 € -
No products
To be determined Shipping
807,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 807,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 807,04 €
Data sheet of ARSJ-arylsulfatase family, member J Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARSJ-arylsulfatase family, member J Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032010 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARSJ |
| Origin species: | Human |
| Product name: | ARSJ-arylsulfatase family, member J Gene |
| Size: | 2ug |
| Accessions: | BC032010 |
| Gene id: | 79642 |
| Gene description: | arylsulfatase family, member J |
| Synonyms: | arylsulfatase J; ASJ; arylsulfatase family member J |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcctgggcagcaggctatgggatctggaacactgcaatccagtcagccatcagagtgcagcactggaaattgcttacaggaaatcctggctacagcgactgggtcccccctcagtctttcagcaacctgggaccgaaccggtggcacaatgaacggatcaccttgtcaactggcaaaagtgtatggcttttcaacatcacagccgacccatatgagagggtggacctatctaacaggtatccaggaatcgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 5', 3'-nucleotidase, cytosolic - histone cluster 2, H2aa4 - 5', 3'-nucleotidase, cytosolic - rhomboid domain containing 2 |