PTXBC018086
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC018086 |
Product type: | DNA & cDNA |
Ncbi symbol: | CDKN2AIPNL |
Origin species: | Human |
Product name: | CDKN2AIPNL-CDKN2A interacting protein N-terminal like Gene |
Size: | 2ug |
Accessions: | BC018086 |
Gene id: | 91368 |
Gene description: | CDKN2A interacting protein N-terminal like |
Synonyms: | CDKN2AIP N-terminal-like protein; CDKN2A-interacting protein N-terminal-like protein; CDKN2A interacting protein N-terminal like |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggtcggtggcgaggcggctgccgcagtggaggagctggtttcgggggtgcggcaggcggccgacttcgcggagcagttccgctcctactcagagagcgagaagcaatggaaggcccgcatggaattcatcctgcgccacctgcccgactaccgcgacccgcccgacggcagtggccgcctggaccagctgctctccctctccatggtctgggccaaccatctcttcctaggctgcagcccacggggtcctaagtag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - ubiquinol-cytochrome c reductase, 6.4kDa subunit - high-mobility group nucleosome binding domain 1 - family with sequence similarity 119, member A - family with sequence similarity 71, member F1 |