Cart 16 Product Products 2 444,38 € (empty)
-
1 x ZNF616-zin...113,40 € -
1 x MAB21L1-ma...121,50 € -
1 x RNASE3-rib...113,40 € -
1 x HLA-DQA1-m...113,40 € -
1 x EIF2B2-euk...121,50 € -
1 x SREC-II...259,07 € -
1 x CXXC5-CXXC...121,50 € -
1 x HLA-DPA1-m...113,40 € -
1 x TGDS-TDP-g...121,50 € -
1 x C14orf65-c...113,40 € -
1 x C11orf65-c...121,50 € -
1 x FAM118A-fa...121,50 € -
-
-
-
No products
To be determined Shipping
2 444,38 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 16 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 444,38 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 444,38 €
View larger 
Data sheet of STRA13-stimulated by retinoic acid 13 homolog (mouse) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about STRA13-stimulated by retinoic acid 13 homolog (mouse) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009571 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | STRA13 |
| Origin species: | Human |
| Product name: | STRA13-stimulated by retinoic acid 13 homolog (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC009571 |
| Gene id: | 201254 |
| Gene description: | stimulated by retinoic acid 13 homolog (mouse) |
| Synonyms: | STRA13; CENP-X; FAAP10; MHF2; centromere protein X; FANCM associated histone fold protein 2; FANCM-interacting histone fold protein 2; Fanconi anemia-associated polypeptide of 10 kDa; retinoic acid-inducible gene D9 protein homolog; stimulated by retinoic acid 13 homolog; stimulated by retinoic acid gene 13 protein homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagggagcaggagctggatccggcttccggaaggagctggtgagcaggctgctgcacctgcacttcaaggatgacaagaccaaagaagcagcagtccgtggcgtgcggcaggcccaggcagaagacgcgctccgtgcggacgtggaccagctggagaaggtgcttccgcagctgctcctggacttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CDKN2A interacting protein N-terminal like - ubiquinol-cytochrome c reductase, 6.4kDa subunit - high-mobility group nucleosome binding domain 1 - family with sequence similarity 119, member A |