Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FOXN3-forkhead box N3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FOXN3-forkhead box N3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010460 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FOXN3 |
| Origin species: | Human |
| Product name: | FOXN3-forkhead box N3 Gene |
| Size: | 2ug |
| Accessions: | BC010460 |
| Gene id: | 1112 |
| Gene description: | forkhead box N3 |
| Synonyms: | C14orf116; CHES1; PRO1635; forkhead box protein N3; checkpoint suppressor 1; forkhead box N3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggatttacacatggcattcagtgttctgtatagatctgcctacctttgtgaattcatctgttaacccctcttcctttgagagagcaccggcgatggtggttaactccttgtgttttctctctctcctactggttattcttgaattaagcacagactcgtcagctcggttgctttatcatgaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - metallothionein 3 - proline rich 15 - trefoil factor 2 - prepronociceptin |