Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FKBP1B-FK506 binding protein 1B, 12.6 kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FKBP1B-FK506 binding protein 1B, 12.6 kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002614 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FKBP1B |
| Origin species: | Human |
| Product name: | FKBP1B-FK506 binding protein 1B, 12.6 kDa Gene |
| Size: | 2ug |
| Accessions: | BC002614 |
| Gene id: | 2281 |
| Gene description: | FK506 binding protein 1B, 12.6 kDa |
| Synonyms: | PPIase FKBP1B; peptidyl-prolyl cis-trans isomerase FKBP1B; FKBP12.6; FKBP1L; OTK4; PKBP1L; PPIase; 12.6 kDa FK506-binding protein; 12.6 kDa FKBP; FK506 binding protein 1B, 12.6 kDa; FK506-binding protein 12.6; FKBP-12.6; FKBP-1B; calstabin 2; h-FKBP-12; immunophilin FKBP12.6; rotamase; FK506 binding protein 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcgtggagatcgagaccatctcccccggagacggaaggacattccccaagaagggccaaacgtgtgtggtgcactacacaggaatgctccaaaatgggaagaagtttgattcatccagagacagaaacaaacctttcaagttcagaattggcaaacaggaagtcatcaaaggttttgaagagggtgcagcccagctgggtcctctttctcctctccccatctgcccccatccctgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Rho GTPase activating protein 17 - fatty acid binding protein 7, brain - fatty acid binding protein 6, ileal - endothelial cell-specific molecule 1 |