Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM165B-family with sequence similarity 165, member B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM165B-family with sequence similarity 165, member B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015596 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM165B |
| Origin species: | Human |
| Product name: | FAM165B-family with sequence similarity 165, member B Gene |
| Size: | 2ug |
| Accessions: | BC015596 |
| Gene id: | 54065 |
| Gene description: | family with sequence similarity 165, member B |
| Synonyms: | protein FAM165B; FAM165B; C21orf51; SMIM11; SMIM11B; small integral membrane protein 11A; family with sequence similarity 165, member B; small integral membrane protein 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaattggaaggttcttgagcacgtgcccctgctgctgtatatcttggcagcaaaaacattaattctctgcctgacatttgctggggtgaaaatgtatcaaagaaaaaggttggaggcaaaacaacaaaaactggaggctgaaaggaagaagcaatcagagaaaaaagataactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - stimulated by retinoic acid 13 homolog (mouse) - CDKN2A interacting protein N-terminal like - ubiquinol-cytochrome c reductase, 6.4kDa subunit - high-mobility group nucleosome binding domain 1 |