SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene

View larger

SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene

Reference: PTXBC022514

Condition: New product

Print

Data sheet of SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC022514
Product type:	DNA & cDNA
Ncbi symbol:	SPINK2
Origin species:	Human
Product name:	SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene
Size:	2ug
Accessions:	BC022514
Gene id:	6691
Gene description:	serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
Synonyms:	HUSI-II; serine protease inhibitor Kazal-type 2; epididymis tissue protein Li 172; serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor); serine peptidase inhibitor, Kazal type 2
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggcgctgtcggtgctgcgcttggcgctgctgctcctggcagttaccttcgcagcctctctgatccctcaatttggtctgttttcaaaatatagaacgccaaactgctctcagtatagattaccaggatgtcccagacactttaaccctgtgtgtggcagtgacatgtccacttatgccaatgaatgtactctgtgcatgaaaatcagggaaggtggtcataatattaaaatcattcgaaatggaccctgctga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits - cytochrome P450, family 2, subfamily B, polypeptide 7 pseudogene 1 - protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched) - major histocompatibility complex, class II, DP beta 2 (pseudogene)

Reviews

Be the first to write your review !

Buy SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene now