MTCP1-mature T-cell proliferation 1 Gene

View larger

MTCP1-mature T-cell proliferation 1 Gene

Reference: PTXBC002600

Condition: New product

Print

Data sheet of MTCP1-mature T-cell proliferation 1 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about MTCP1-mature T-cell proliferation 1 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC002600
Product type:	DNA & cDNA
Ncbi symbol:	MTCP1
Origin species:	Human
Product name:	MTCP1-mature T-cell proliferation 1 Gene
Size:	2ug
Accessions:	BC002600
Gene id:	4515
Gene description:	mature T-cell proliferation 1
Synonyms:	P13MTCP1; p8MTCP1; protein p13 MTCP-1; MTCP-1 type B1; mature T-cell proliferation 1 isoform p13; mature T-cell proliferation-1 type B1; mature T-cell proliferation 1
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgccgcagaaggatccgtgccagaagcaagcctgtgagatacagaaatgtttacaagccaacagctacatggaatcaaagtgtcaggctgtcatccaagaactgcgtaagtgttgtgctcagtatcccaagggaagatctgtcgtctgttcaggatttgaaaaagaagaggaagaaaacctaacacggaagtctgcatcaaagtaa
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- arylsulfatase family, member J - 5', 3'-nucleotidase, cytosolic - histone cluster 2, H2aa4 - 5', 3'-nucleotidase, cytosolic

Reviews

Be the first to write your review !

Buy MTCP1-mature T-cell proliferation 1 Gene now