OTUB2-OTU domain, ubiquitin aldehyde binding 2 Gene View larger

OTUB2-OTU domain, ubiquitin aldehyde binding 2 Gene

PTXBC000208

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OTUB2-OTU domain, ubiquitin aldehyde binding 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about OTUB2-OTU domain, ubiquitin aldehyde binding 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000208
Product type: DNA & cDNA
Ncbi symbol: OTUB2
Origin species: Human
Product name: OTUB2-OTU domain, ubiquitin aldehyde binding 2 Gene
Size: 2ug
Accessions: BC000208
Gene id: 78990
Gene description: OTU domain, ubiquitin aldehyde binding 2
Synonyms: ubiquitin-specific-processing protease OTUB2; deubiquitinating enzyme OTUB2; ubiquitin thioesterase OTUB2; C14orf137; OTB2; OTU2; OTU domain, ubiquitin aldehyde binding 2; OTU domain-containing ubiquitin aldehyde-binding protein 2; otubain-2; ubiquitin-specific protease otubain 2; OTU deubiquitinase, ubiquitin aldehyde binding 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtctatgagaagtacactggaagcgtggggggaacacatgacatgatttgtgaatatcatcatctttgccagacaagtctccaggggatccctgtttcccaactgaaaggtgtgaacggacacacacacagcctggatgacgccttggctgttctaaggggctgtaaggtgggctctgggccttccagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 10 open reading frame 116
- family with sequence similarity 27-like
- phosphoprotein enriched in astrocytes 15
- chromosome 20 open reading frame 149

Reviews

Buy OTUB2-OTU domain, ubiquitin aldehyde binding 2 Gene now

Add to cart