Cart 60 Product Products 25 434,58 € (empty)
-
-
1 x TRIP13-thy...121,50 € -
1 x ELOVL2-elo...121,50 € -
1 x NXPH4-neur...121,50 € -
1 x BIK-BCL2-i...113,40 € -
1 x HPRT1-hypo...113,40 € -
-
-
1 x GRPEL2-Grp...113,40 € -
1 x LENG1-leuk...113,40 € -
1 x UBL5-ubiqu...113,40 € -
1 x RPL23A-rib...113,40 € -
1 x ZNF266-zin...113,40 € -
1 x PGDS-prost...113,40 € -
1 x DLX6-dista...113,40 € -
-
1 x ANKRD22-an...113,40 € -
1 x SSSCA1-Sjo...113,40 € -
1 x SMAP2-smal...121,50 € -
1 x H2AFX-H2A...113,40 € -
1 x CRTAM-cyto...121,50 € -
1 x RPLP2-ribo...113,40 € -
-
1 x ORC4L-orig...113,40 € -
1 x RBPMS-RNA...113,40 € -
1 x MAP2K5-mit...121,50 € -
1 x HLA-DRB3-m...121,50 € -
1 x GATC-gluta...113,40 € -
1 x C7orf44-ch...113,40 € -
1 x APOM-apoli...113,40 € -
1 x PNPLA1-pat...121,50 € -
1 x TPPP-tubul...113,40 € -
1 x BARX1-BARX...113,40 € -
1 x DDA1-DET1...113,40 € -
1 x FGFRL1-fib...121,50 € -
1 x IFNW1-inte...113,40 € -
1 x GSTA4-glut...113,40 € -
1 x PI4KAP1-ph...113,40 € -
-
-
1 x ANKS1B-ank...121,50 € -
1 x JTV1-JTV1...121,50 € -
1 x PPP4R1L-pr...121,50 € -
-
1 x ANXA8L2-an...121,50 € -
1 x SLC37A4-so...121,50 € -
1 x GATA1-GATA...121,50 € -
1 x DOLPP1-dol...113,40 € -
-
-
1 x SEC61A1-Se...121,50 € -
1 x LMX1B...259,07 € -
-
1 x MS4A4A-mem...113,40 € -
1 x RASL11A-RA...113,40 € -
1 x Goat...4 064,52 € -
1 x HPX-hemope...113,40 € -
1 x FOXP1-fork...113,40 € -
1 x FAM98C-fam...113,40 € -
No products
To be determined Shipping
25 434,58 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 60 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 25 434,58 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 25 434,58 €
View larger 
TELO2-TEL2, telomere maintenance 2, homolog (S. cerevisiae) Gene
PTXBC017188
New product
Data sheet of TELO2-TEL2, telomere maintenance 2, homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TELO2-TEL2, telomere maintenance 2, homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC017188 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TELO2 |
| Origin species: | Human |
| Product name: | TELO2-TEL2, telomere maintenance 2, homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC017188 |
| Gene id: | 9894 |
| Gene description: | TEL2, telomere maintenance 2, homolog (S. cerevisiae) |
| Synonyms: | CLK2; TEL2; YHFS; telomere length regulation protein TEL2 homolog; TEL2, telomere maintenance 2, homolog; protein clk-2 homolog; telomere maintenance 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagccagcaccctcagaggttcgactcgccgtccgggaagccattcatgccctctcgtcttcggaggatggcggccacatcttctgcaccctggagtccctgaagcggtatctcggtgagatggagcctccagcgctcccgagggagaaggaggagtttgcctcggcccacttctcgcctgtcctcagatgtcttgccagcaggctgagcccagcctggctggagctgctgccccatggccgcctggaggagctgtgggccagcttcttcctggagggcccggcggaccaagccttcctggtgttgatggagaccatcgagggtgctgcgggccccagcttccggctgatgaagatggcgcggctgctggccagattcctgcgcgagggccggctggcagtgctgatggaggcgcagtgtcggcagcagacgcggcccggcttcatcctgctccgggagacgctgctgggcaaggtggtggccctgcccgatcacctgggcaaccgcctgcagcaggagaacttggccgagttcttcccccagaactacttccgcctgctcggcgaggaggtcgtccgggtgctgcaggcggttgtggactctctccaaggtggcctggattcctccgtgtccttcgtgtctcaggtccttgggaaagcctgtgtccacgggaggcagcaggagatcctgggcgtgctggtaccccggctggcagcgctcacccagggcagctacctgcaccagcgcgtctgctggcgcctggtggagcaagtgccggaccgggccatggaggctgtgctgaccgggctggtggaggccgcactggggcctgaggtcctttcgagactgctggggaacctggtggtgaagaacaagaaggcccagtttgtgatgacccagaagcttctgttcttacagtcccggctcacgacgcccatgctgcagagcctgctgggccatctggccatggacagccagcggcgcccgctcctgctgcaggtgctgaaggagctgttggagacgtggggcagcagcagtgccatccgccacactcccctgccgcagcagcgccacgtcagcaaggctgtcctcatctgcctggcgcaactcggggagccggaactgcgggacagccgggatgaactgctggccagcatgatggcgggcgtgaagtgccgcctggacagtagcctgccccccgtgcgacgcctgggcatgatcgtggcagaggtcgttagtgcccggatccaccccgaggggcctcccctgaaattccagtacgaagaggatgaactgagcctcgagctgctggccttggcctccccccagcctgcgggtgacggcgcctcggaggcgggcacgtccctcgttccagccacggcagagccccctgcagagacccccgcagagatcgtggatggcggcgtcccccaagcacagctggcgggctctgactcggacctggacagcgatgatgagtttgtcccctacgacatgtcgggggacagagagctgaagagcagcaaggctcctgcctacgtccgggactgcgtggaagccctgaccacgtctgaggacatagagcgctgggaggcagccctgcgggcccttgagggcctggtctacaggagccccacagccactcgggaggtgagcgtggagctggccaaggtgcttctgcatctggaggagaagacctgtgtggtgggatttgcagggctgcgccagagagccctggtggccgtcacggtcacagacccggccccggtggccgactatctgacctcacagttctatgccctcaactacagcctccggcagcgcatggacatcctggatgtgctgactctggctgcccaggagctgtctaggcctgggtgcctcgggaggactccccaacctggctccccaagtcccaacaccccgtgcctgccagaggcagccgtctctcagcctggcagtgccgtggcgtctgactggcgggtggtggtggaggagcggatcagaagcaagacccagcggctctccaagggtggcccgaggcagggcccggcaggcagccccagcagattcaactccgtggccggccacttcttcttccccctccttcagcgctttgacaggcctctggtgaccttcgacctcttgggagaagaccagctggttctcggaaggctggcgcacaccttaggggccctgatgtgcctggctgttaacaccacggtggctgtggccatgggcaaggccctgctggaattcgtgtgggcccttcgcttccacatcgatgcctacgtgcgccaggggctgttgtcggccgtctcctccgtcctgctcagcctgcctgctgcgcgcctgctggaggacctgatggacgagctgctggaagcccggtcctggctggcggacgtggctgagaaagacccggacgaggactgcaggacgctggcactgagggccctgctgcttctgcagagactcaagaacaggctcctcccacccgcgtctccctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coatomer protein complex, subunit beta 2 (beta prime) - sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1 - potassium voltage-gated channel, shaker-related subfamily, beta member 1 - solute carrier family 6 (neurotransmitter transporter, GABA), member 13 |