Cart 9 Product Products 1 033,37 € (empty)
-
1 x ISG20L2-in...121,50 € -
-
-
1 x NPTN-neuro...121,50 € -
1 x LIPA-lipas...121,50 € -
-
1 x PSMB10-pro...121,50 € -
-
No products
To be determined Shipping
1 033,37 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 033,37 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 033,37 €
View larger 
SLC2A5-solute carrier family 2 (facilitated glucose/fructose transporter), member 5 Gene
PTXBC001692
New product
Data sheet of SLC2A5-solute carrier family 2 (facilitated glucose/fructose transporter), member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC2A5-solute carrier family 2 (facilitated glucose/fructose transporter), member 5 Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC001692 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC2A5 |
| Origin species: | Human |
| Product name: | SLC2A5-solute carrier family 2 (facilitated glucose/fructose transporter), member 5 Gene |
| Size: | 2ug |
| Accessions: | BC001692 |
| Gene id: | 6518 |
| Gene description: | solute carrier family 2 (facilitated glucose/fructose transporter), member 5 |
| Synonyms: | GLUT-5; solute carrier family 2, facilitated glucose transporter member 5; glucose transporter type 5, small intestine; glucose transporter-like protein 5; solute carrier family 2 (facilitated glucose/fructose transporter), member 5; testicular tissue protein Li 81; solute carrier family 2 member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcaacaggatcagagcatgaaggaagggaggctgacgcttgtgcttgccctggcaaccctgatagctgcctttgggtcatccttccagtatgggtacaacgtggctgctgtcaactccccagcactgctcatgcaacaattttacaatgagacttactatggtaggaccggtgaattcatggaagacttccccttgacgttgctgtggtctgtaaccgtgtccatgtttccatttggagggtttatcggatccctcctggtcggccccttggtgaataaatttggcagaaaaggggccttgctgttcaacaacatattttctatcgtgcctgcgatcttaatgggatgcagcagagtcgccacatcatttgagcttatcattatttccagacttttggtgggaatatgtgcaggtgtatcttccaacgtggtccccatgtacttaggggagctggcccctaaaaacctgcggggggctctcggggtggtgccccagctcttcatcactgttggcatccttgtggcccagatctttggtcttcggaatctccttgcaaacgtagatggctggccgatcctgctggggctgaccggggtccccgcggcgctgcagctccttctgctgcccttcttccccgagagccccaggtacctgctgattcagaagaaagacgaagcggccgccaagaaagccctacagacgctgcgcggctgggactctgtggacagggaggtggccgagatccggcaggaggatgaggcagagaaggccgcgggcttcatctccgtgctgaagctgttccggatgcgctcgctgcgctggcagctgctgtccatcatcgtcctcatgggcggccagcagctgtcgggcgtcaacgctatctactactacgcggaccagatctacctgagcgccggcgtgccggaggagcacgtgcagtacgtgacggccggcaccggggccgtgaacgtggtcatgaccttctgcgccgtgttcgtggtggagctcctgggtcggaggctgctgctgctgctgggcttctccatctgcctcatagcctgctgcgtgctcactgcagctctggcactgcaggacacagtgtcctggatgccatacatcagcatcgtctgtgtcatctcctacgtcataggacatgccctcgggcccagtcccatacccgcgctgctcatcactgagatcttcctgcagtcctctcggccatctgccttcatggtggggggcagtgtgcactggctctccaacttcaccgtgggcttgatcttcccgttcatccaggagggcctcggcccgtacagcttcattgtcttcgccgtgatctgcctcctcaccaccatctacatcttcttgattgtcccggagaccaaggccaagacgttcatagagatcaaccagattttcaccaagatgaataaggtgtctgaagtgtacccggaaaaggaggaactgaaagagcttccacctgtcacttcggaacagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1 - thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian) - tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain |