Cart 3 Product Products 337,24 € (empty)
-
1 x TECTB-tect...121,50 € -
-
No products
To be determined Shipping
337,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 337,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 337,24 €
Data sheet of CETN2-centrin, EF-hand protein, 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CETN2-centrin, EF-hand protein, 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005334 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CETN2 |
| Origin species: | Human |
| Product name: | CETN2-centrin, EF-hand protein, 2 Gene |
| Size: | 2ug |
| Accessions: | BC005334 |
| Gene id: | 1069 |
| Gene description: | centrin, EF-hand protein, 2 |
| Synonyms: | CALT; CEN2; centrin-2; caltractin (20kD calcium-binding protein); centrin, EF-hand protein, 2; centrin 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctccaactttaagaaggcaaacatggcatcaagttctcagcgaaaaagaatgagccctaagcctgagcttactgaagagcaaaagcaggagatccgggaagcttttgatcttttcgatgcggatggaactggcaccatagatgttaaagaactgaaggtggcaatgagggccctgggctttgaacccaagaaagaagaaattaagaaaatgataagtgaaattgataaggaagggacaggaaaaatgaactttggtgactttttaactgtgatgacccagaaaatgtctgagaaagatactaaagaagaaatcctgaaagctttcaagctctttgatgatgatgaaactgggaagatttcgttcaaaaatctgaaacgcgtggccaaggagttgggtgagaacctgactgatgaggagctgcaggaaatgattgatgaagctgatcgagatggagatggagaggtcagtgagcaagagttcctgcgcatcatgaaaaagaccagcctctattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 3-oxoacid CoA transferase 1 - SAM domain and HD domain 1 - exocyst complex component 6 - mediator complex subunit 15 |