Cart 6 Product Products 924,76 € (empty)
-
1 x RGS1...259,07 € -
1 x FAM163A-fa...113,40 € -
1 x TMPO-thymo...121,50 € -
1 x RASSF8-Ras...121,50 € -
-
1 x TSPAN12-te...121,50 €
No products
To be determined Shipping
924,76 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 924,76 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 924,76 €
Data sheet of RGS1-regulator of G-protein signaling 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RGS1-regulator of G-protein signaling 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015510 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RGS1 |
| Origin species: | Human |
| Product name: | RGS1-regulator of G-protein signaling 1 Gene |
| Size: | 2ug |
| Accessions: | BC015510 |
| Gene id: | 5996 |
| Gene description: | regulator of G-protein signaling 1 |
| Synonyms: | 1R20; BL34; HEL-S-87; IER1; IR20; regulator of G-protein signaling 1; B-cell activation protein BL34; early response protein 1R20; epididymis secretory protein Li 87; immediate-early response 1, B-cell specific; regulator of G-protein signalling 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaggaatgttcttctctgctaacccaaaggaattgaaaggaaccactcattcacttctagacgacaaaatgcaaaaaaggaggccaaagacttttggaatggatatgaaagcatacctgagatctatgatcccacatctggaatctggaatgaaatcttccaagtccaaggatgtactttctgctgctgaagtaatgcaatggtctcaatctctggaaaaacttcttgccaaccaaactggtcaaaatgtctttggaagtttcctaaagtctgaattcagtgaggagaatattgagttctggctggcttgtgaagactataagaaaacagagtctgatcttttgccctgtaaagcagaagagatatataaagcatttgtgcattcagatgctgctaaacaaatcaatattgacttccgcactcgagaatctacagccaagaagattaaagcaccaacccccacgtgttttgatgaagcacaaaaagtcatatatactcttatggaaaaggactcttatcccaggttcctcaaatcagatatttacttaaatcttctaaatgacctgcaggctaatagcctaaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eyes absent homolog 2 (Drosophila) - leucine-rich, glioma inactivated 1 - coiled-coil domain containing 22 - coiled-coil domain containing 45 |