Cart 8 Product Products 931,50 € (empty)
-
1 x C10orf81-c...121,50 € -
1 x TXNDC9-thi...113,40 € -
1 x C5orf4-chr...121,50 € -
1 x C10orf78-c...113,40 € -
1 x C1orf94-ch...121,50 € -
1 x SNX10-sort...113,40 € -
1 x ZSCAN2-zin...113,40 € -
1 x PSMA1-prot...113,40 €
No products
To be determined Shipping
931,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 931,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 931,50 €
Data sheet of GPNMB-glycoprotein (transmembrane) nmb Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPNMB-glycoprotein (transmembrane) nmb Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011595 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPNMB |
| Origin species: | Human |
| Product name: | GPNMB-glycoprotein (transmembrane) nmb Gene |
| Size: | 2ug |
| Accessions: | BC011595 |
| Gene id: | 10457 |
| Gene description: | glycoprotein (transmembrane) nmb |
| Synonyms: | HGFIN; NMB; transmembrane glycoprotein NMB; glycoprotein (transmembrane) nmb; glycoprotein nmb-like protein; glycoprotein nonmetastatic melanoma protein B; hematopoietic growth factor inducible neurokinin-1; osteoactivin; transmembrane glycoprotein HGFIN; glycoprotein nmb |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaatgtctctactatttcctgggatttctgctcctggctgcaagattgccacttgatgccgccaaacgatttcatgatgtgctgggcaatgaaagaccttctgcttacatgagggagcacaatcaattaaatggctggtcttctgatgaaaatgactggaatgaaaaactctacccagtgtggaagcggggagacatgaggtggaaaaactcctggaagggaggccgtgtgcaggcggtcctgaccagtgactcaccagccctcgtgggctcaaatataacatttgcggtgaacctgatattccctagatgccaaaaggaagatgccaatggcaacatagtctatgagaagaactgcagaaatgaggctggtttatctgctgatccatatgtttacaactggacagcatggtcagaggacagtgacggggaaaatggcaccggccaaagccatcataacgtcttccctgatgggaaaccttttcctcaccaccccggatggagaagatggaatttcatctacgtcttccacacacttggttggcttttacaaacccctaagcttcttctttacctttccttaaaatttcaaccttctcttttcttactctataattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - parathyroid hormone-like hormone - DENN/MADD domain containing 2D - myotubularin related protein 14 - unc-51-like kinase 4 (C. elegans) |