PRUNE2-prune homolog 2 (Drosophila) Gene View larger

PRUNE2-prune homolog 2 (Drosophila) Gene

PTXBC022571

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRUNE2-prune homolog 2 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PRUNE2-prune homolog 2 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022571
Product type: DNA & cDNA
Ncbi symbol: PRUNE2
Origin species: Human
Product name: PRUNE2-prune homolog 2 (Drosophila) Gene
Size: 2ug
Accessions: BC022571
Gene id: 158471
Gene description: prune homolog 2 (Drosophila)
Synonyms: truncated PRUNE2; BMCC1; BNIPXL; C9orf65; KIAA0367; protein prune homolog 2; BCH motif-containing molecule at the carboxyl terminal region 1; BNIP2 motif containing molecule at the carboxyl terminal region 1; BNIP2 motif-containing molecule at the C-terminal region 1; olfaxin; prune homolog 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacatcccctttgaagagggcgtgctgagtcccagtgctgcagacatgaggcctgaacctcctaattctctggatcttaatgacactcatcctcggagaatcaagctcacagccccaaatatcaatctttctctggaccaaagtgaaggatctattctctctgatgataacttggacagtcctgatgaaattgacatcaatgtggatgaacttgatacccccgatgaagcagattcttttgagtacactggccatgaagatcccacagccaacaaagattctggccaagagtcagagtctattccagaatatacggccgaagaggaacgggaggacaaccggctttggaggacagtggtcattggagaacaagagcagcgcattgacatgaaggtcatcgagccctacaggagagtcatttctcacggaggatactatggggacggtctaaatgccatcattgtgtttgccgcctgttttctgccagacagcagtcgggcggattaccactatgtcatggaaaatcttttcctatatgtaataagtactttcacactacagccgcagagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosylation factor-like 1
- armadillo repeat containing 9
- oxidative-stress responsive 1
- 5'-nucleotidase, cytosolic II

Reviews

Buy PRUNE2-prune homolog 2 (Drosophila) Gene now

Add to cart