Cart 34 Product Products 4 902,03 € (empty)
-
1 x OLA1-Obg-l...121,50 € -
1 x IFI27-inte...113,40 € -
1 x C10orf111-...113,40 € -
1 x OGN-osteog...121,50 € -
1 x GDAP1L1-ga...121,50 € -
1 x NKIRAS2-NF...113,40 € -
-
1 x HBB-hemogl...113,40 € -
1 x HSPC152-hy...113,40 € -
1 x STT3B-STT3...113,40 € -
1 x GDE1-glyce...113,40 € -
-
1 x Visfatin...694,00 € -
1 x RGS4-regul...113,40 € -
1 x HBXIP-hepa...113,40 € -
-
-
1 x HAGHL-hydr...121,50 € -
1 x SERPINH1-s...121,50 € -
1 x C21orf122-...113,40 € -
1 x KLHDC3-kel...121,50 € -
1 x SERPINE2-s...121,50 € -
1 x NXF5-nucle...121,50 € -
1 x OAT-ornith...121,50 € -
1 x APH1A-ante...113,40 € -
1 x ETNK1-etha...121,50 € -
-
-
1 x SERINC2-se...113,40 € -
1 x GTF2A2-gen...113,40 € -
1 x PRR13-prol...113,40 € -
1 x HDAC8-hist...121,50 € -
-
No products
To be determined Shipping
4 902,03 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 34 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 902,03 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 902,03 €
View larger 
Data sheet of DCTN1-dynactin 1 (p150, glued homolog, Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DCTN1-dynactin 1 (p150, glued homolog, Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006163 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DCTN1 |
| Origin species: | Human |
| Product name: | DCTN1-dynactin 1 (p150, glued homolog, Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC006163 |
| Gene id: | 1639 |
| Gene description: | dynactin 1 (p150, glued homolog, Drosophila) |
| Synonyms: | DAP-150; DP-150; P135; dynactin subunit 1; 150 kDa dynein-associated polypeptide; dynactin 1 (p150, glued homolog, Drosophila) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaggcccagggctggtgaaggactcaccactgctgcttcagcagatctctgccatgaggctgcacatctcccagctccagcatgagaacagcatcctcaagggagcccagatgaaggcatccttggcatccctgccccctctgcatgttgcaaagctatcccatgagggccctggcagtgagttaccagctggagcgctgtatcgtaagaccagccagctgctggagacattgaatcaattgagcacacacacgcacgtagtagacatcactcgcaccagccctgctgccaagagcccgtcggcccaacttatggagcaagtggctcagcttaagtccctgagtgacaccgtcgagaagctcaaggatgaggtcctcaaggagacagtatctcagcgccctggagccacagtacccactgactttgccaccttcccttcatcagccttcctcagggccaaggaggagcagcaggatgacacagtctacatgggcaaagtgaccttctcatgtgcggctggttttggacagcgacaccggctggtgctgacccaggagcagctgcaccagcttcacagtcgcctcatctcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aldehyde dehydrogenase 6 family, member A1 - phosphoribosyl pyrophosphate amidotransferase - ABI family, member 3 (NESH) binding protein - eukaryotic translation initiation factor 4E binding protein 3 |