NOL6-nucleolar protein family 6 (RNA-associated) Gene

View larger

NOL6-nucleolar protein family 6 (RNA-associated) Gene

Reference: PTXBC008298

Condition: New product

Print

Data sheet of NOL6-nucleolar protein family 6 (RNA-associated) Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about NOL6-nucleolar protein family 6 (RNA-associated) Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC008298
Product type:	DNA & cDNA
Ncbi symbol:	NOL6
Origin species:	Human
Product name:	NOL6-nucleolar protein family 6 (RNA-associated) Gene
Size:	2ug
Accessions:	BC008298
Gene id:	65083
Gene description:	nucleolar protein family 6 (RNA-associated)
Synonyms:	NRAP; UTP22; bA311H10.1; nucleolar protein 6; nucleolar RNA-associated protein; nucleolar protein 6 (RNA-associated); nucleolar protein family 6 (RNA-associated)
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atggtcattgttaccccccaagaccgcaaaaactctgtgtggacacaggatggaccctcagcccagatcctgcagcagcttgtggtcctggcagctgaagccctgcccatgttagagaagcagctcatggatccccggggacctggggacatcaggacagtgttccggccgcccttggacatttacgacgtgctgattcgcctgtctcctcgccatatcccgcggcaccgccaggctgtggactcgccagctgcctccttctgccggggcctgctcagccagccggggccctcatccctgatgcccgtgctgggctatgatcctcctcagctctatctgacgcagctcagggaggcctttggggatctggcccttttcttctatgaccagcatggtggagaggtgattggtgtcctctggaagcccaccagcttccagccgcagcccttcaaggcctccagcacaaaggggcgcatggtgatgtctcgaggtggggagctagtaatggtgcccaatgttgaagcaatcctggaggactttgctgtgctgggtgaaggcctggtgcagactgtggaggcccgaagtgagaggtggactgtgtga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- chromodomain helicase DNA binding protein 2 - cytochrome c oxidase subunit IV isoform 1 - DEAD (Asp-Glu-Ala-As) box polypeptide 19A - amyloid beta (A4) precursor-like protein 2

Reviews

Be the first to write your review !

Buy NOL6-nucleolar protein family 6 (RNA-associated) Gene now