Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLR2E-polymerase (RNA) II (DNA directed) polypeptide E, 25kDa Gene
PTXBC004441
New product
Data sheet of POLR2E-polymerase (RNA) II (DNA directed) polypeptide E, 25kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLR2E-polymerase (RNA) II (DNA directed) polypeptide E, 25kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004441 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR2E |
| Origin species: | Human |
| Product name: | POLR2E-polymerase (RNA) II (DNA directed) polypeptide E, 25kDa Gene |
| Size: | 2ug |
| Accessions: | BC004441 |
| Gene id: | 5434 |
| Gene description: | polymerase (RNA) II (DNA directed) polypeptide E, 25kDa |
| Synonyms: | RPABC1; RPB5; XAP4; hRPB25; hsRPB5; DNA-directed RNA polymerases I, II, and III subunit RPABC1; DNA directed RNA polymerase II 23 kda polypeptide; DNA-directed RNA polymerase II 23 kDa polypeptide; DNA-directed RNA polymerase II subunit E; DNA-directed RNA polymerase subunit RPABC1; RNA polymerases I, II, and III subunit ABC1; RPB5 homolog; polymerase (RNA) II (DNA directed) polypeptide E, 25kDa; polymerase (RNA) II subunit E; RNA polymerase II subunit E |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgacgaggaggagacgtaccggctctggaaaatccgcaagaccatcatgcagctgtgccacgaccgtggctatctggtgacccaggacgagcttgaccagaccctggaggagttcaaagcccaatttggggacaagccgagtgaggggcggccgcggcgcacggacctcaccgtgctggtggcccacaacgatgaccccaccgaccagatgtttgtgttctttccagaggagcccaaggtgggcatcaagaccatcaaggtgtactgccagcgcatgcaggaggagaacatcacacgggctctcatcgtggtgcagcagggcatgacaccctccgccaagcagtccctggtcgacatggcccccaagtacatcctggagcagtttctgcagcaggagctgctcatcaacatcacggagcacgagctagtccctgagcacgtcgtcatgaccaaggaggaggtgacagagctgctggcccgatataagctccgagagaaccagctgcccaggatccaggcgggggaccctgtggcgcgctactttgggataaagcgtgggcaggtggtgaagatcatccggcccagtgagacggctggcaggtacatcacctaccggctggtgcagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 1, regulatory (inhibitor) subunit 2 - papillary renal cell carcinoma (translocation-associated) - smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) - cytochrome P450, family 4, subfamily F, polypeptide 11 |