PTXBC002864
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC002864 |
Product type: | DNA & cDNA |
Ncbi symbol: | RCAN1 |
Origin species: | Human |
Product name: | RCAN1-regulator of calcineurin 1 Gene |
Size: | 2ug |
Accessions: | BC002864 |
Gene id: | 1827 |
Gene description: | regulator of calcineurin 1 |
Synonyms: | ADAPT78; CSP1; DSC1; DSCR1; MCIP1; RCN1; calcipressin-1; Down syndrome candidate region 1; Down syndrome critical region gene 1; calcium and oxidant-inducible mRNA; modulatory calcineurin-interacting protein 1; myocyte-enriched calcineurin-interacting protein 1; near DSCR proline-rich protein; regulator of calcineurin 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggaggaggtggacctgcaggacctgcccagcgccaccatcgcctgtcacctggacccgcgcgtgttcgtggacggcctgtgccgggccaaatttgagtccctctttaggacgtatgacaaggacatcacctttcagtattttaagagcttcaaacgagtcagaataaacttcagcaaccccttctccgcagcagatgccaggctccagctgcataagactgagtttctgggaaaggaaatgaagttatattttgctcagaccttacacataggaagctcacacctggctccgccaaatccagacaagcagtttctgatctcccctcccgcctctccgccagtgggatggaaacaagtggaagatgcgaccccagtcataaactatgatctcttatatgccatctccaagctggggccaggggaaaagtatgaattgcacgcagcgactgacaccactcccagcgtggtggtccatgtatgtgagagtgatcaagagaaggaggaagaagaggaaatggaaagaatgaggagacctaagccaaaaattatccagaccaggaggccggagtacacgccgatccacctcagctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - nuclear RNA export factor 1 - nuclear RNA export factor 2 - SECIS binding protein 2 - collagen, type I, alpha 1 |